Abstract
Aim
Acne vulgaris is a persistent inflammatory condition affecting the pilosebaceous unit. Tissue inhibitor of metalloproteinase-2 (TIMP-2) is an endogenous inhibitor of matrix metalloproteinase-2 (MMP-2) that controls MMP-2 proteolytic activity. This study was designed to evaluate serum and gene expression levels of TIMP-2 in patients with acne vulgaris compared with healthy controls, and to correlate these results with available clinical data.
Materials and Methods
This case-control study included 83 cases of acne vulgaris and 83 normal controls. Disease severity was estimated by the Global Acne Grading System (GAGS). Real-time polymerase chain reaction was used to determine TIMP-2 gene expression, and serum TIMP-2 levels were assessed by enzyme-linked immunosorbent assay.
Results
Comparison between cases and controls showed statistically significant differences in mean serum levels and TIMP-2 expression levels, with levels higher in cases than in controls (P< 0.001 for both). Significant positive correlations were observed between mean serum TIMP-2 levels and the GAGS score, NAST classification, and TIMP-2 gene expression (P < 0.001 for all). Significant positive correlations were observed between TIMP-2 gene expression and both the GAGS score and the NAST classification (P < 0.001 for both).
Conclusion
Serum TIMP-2 levels and TIMP-2 gene expression are significantly elevated in patients with acne vulgaris and positively correlate with disease severity. These findings suggest that TIMP-2 may play a role in acne pathogenesis and could serve as a biomarker of disease activity.
INTRODUCTION
Acne vulgaris ranks as one of the most prevalent dermatological problems affecting the pilosebaceous unit, which is made up of the hair follicle, shaft, and sebaceous gland.1 Acne vulgaris typically begins in adolescence, reaches a peak prevalence of about 95% between the ages of 14 and 19 and often resolves by the middle of one’s 20s.2
Acne vulgaris commonly presents as pimples, nodules, pustules, and cysts, and these lesions can often result in pigmentation and scarring. Patients with severe acne may have permanently disfiguring scars, which may negatively affect their appearance and their psychological health.3
Acne has a complex, heterogeneous pathophysiology. The main pathogenic factors include androgen stimulation of sebaceous secretion, increased sebum secretion, and follicular hyperkeratinisation. It has been suggested that microbial colonization by Cutibacterium acnes (C. acnes) increases perifollicular inflammation, which is a crucial early step in the development of acne vulgaris.4
Many matrix metalloproteinases (MMPs), including MMP-1, MMP-2, MMP-3, MMP-9, and MMP-13, can be stimulated by C. acnes.5 MMPs’ primary function is to degrade all components of the extracellular matrix. However, they also play a part in inflammation, cell development, proliferation, and remodeling, as well as influencing the production and release of cytokines and chemokines.6
Tissue inhibitor of metalloproteinase-2 (TIMP-2) is an endogenous inhibitor of MMP-2, regulating its proteolytic activity.7 TIMP-2, located on the long arm of chromosome 17, locus number (25), has been shown to regulate the proteolytic activity of MMP-2 through the enzyme’s production of a 1:1 stoichiometric suppressive complex.8
TIMP-2 and MMP-2 interact via a mechanism more complex than a simple inhibitor-substrate interaction. The relation between TIMP-2 and MMP-2 is concentration-dependent. At low concentrations, TIMP-2 can bind to membrane type-1 MMP and the carboxyl-terminal hemopexin-like domain of MMP-2, activating pro-MMP-2 and promoting its maturation. At high concentrations, TIMP-2 can bind MMP-2 via its N-terminal domain, thereby inhibiting MMP-2 activity.9
The study aims to assess TIMP-2 messenger ribonucleic acid (mRNA) expression and serum TIMP-2 levels in patients with acne vulgaris of varying grades and to correlate these findings with available clinical data.
MATERIALS AND METHODS
In this case-control study, 83 patients with acne vulgaris served as the case group, and 83 age- and gender-matched healthy subjects served as the control group.
Inclusion Standards
The following individuals were recruited to participate in the study after obtaining informed consent: patients presenting with acne vulgaris who had not received treatment for three months, had no history of skin resurfacing, and had not used oral isotretinoin in the previous six months.
Exclusion Standards
Exclusion criteria are as follows: patients with a history of diabetes mellitus; patients who are obese; females with polycystic ovary syndrome; patients with chronic or acute hepatitis; patients with liver cirrhosis; patients with benign or malignant tumours; patients with inflammatory bowel disease; patients with chronic pancreatitis; patients with cardiovascular diseases, autoimmune disorders, malignancy, or asthma; patients receiving drugs that cause acneiform eruptions; patients with a known history of lipid metabolic disorder or those taking drugs that affect lipid metabolism; subjects with acne conglobata, acne fulminans, secondary acne (chloracne, drug-induced acne, etc.), or any other cutaneous or fibrotic lesions.
Sample Size Calculation
A study proposing to evaluate the effect of TIMP-2 mRNA expression on acne vulgaris of varying severity, compared with healthy controls. A previous study showed that the distribution of the GC genotype for the TIMP-2 (-418 G/C) polymorphism differed between the patient and control groups, 14.8% vs. 33.3%, respectively.10 Thus, the sample size for the current study, to detect a significant effect at P < 0.05 with 80% power was calculated using the following formula:
In the above formula, Z1-α/2 = 1.96; β = 0.2; r = 1. So, n = 83. Thus, at least 166 individuals should be recruited for the study, with at least 83 in each group. n is the minimum sample size for the group. Z1-α/2 denotes the standardized value corresponding to the specified confidence level. At 95% confidence interval (CI), it is 1.96, and at 99% CI (1% type I error), it is 2.58. The sample consisted of 166 patients.
Consent to Participate and Ethics
Prior to the initiation of the study, ethical approval was obtained from the Research Ethics Committee, Institutional Review Board, Faculty of Medicine, Menoufia University (approval no: DERMA 27; approval date: 27 October 2022). The study was conducted in accordance with the principles of the Declaration of Helsinki. Cases were consecutively recruited from the Outpatient Clinic of Dermatology, Andrology and STDs at Menoufia University Hospitals. Each participant provided written informed consent before the start of the study, which was approved by the Local Ethical Research Committee of Menoufia Faculty of Medicine. One of the patients’ parents provided consent for the patients under the age of eighteen. Every enrolled patient underwent thorough history-taking and a detailed dermatological examination. Along with other clinical information, the following were gathered: onset, progression, lesion location, aggravating factors (food, stress, pregnancy, menstruation, sun exposure, etc.), and family history.
Clinical evaluation of the enrolled patients was performed in accordance with Nast et al.,11 who assessed acne vulgaris as follows: the microcomedone gave rise to non-inflammatory lesions, including both closed (whiteheads) and open (blackheads) comedones. Inflammatory lesions were either deep or superficial. The terms papules and pustules refer to superficial inflammatory lesions measuring ≤ 5 mm in diameter. In more severe cases, lesions could progress to nodules or deep pustules.
Evaluation of Acne Vulgaris Severity
Acne vulgaris was categorized according to the method described by Tan.12 Mild acne was defined as the presence of < 20 comedones, < 15 inflammatory lesions, or < 30 total lesions. Moderate acne was defined as 20–100 comedones, 15–50 inflammatory lesions, or a total lesion count of 30–125. Severe acne vulgaris was defined as the presence of more than five cysts, more than 100 comedones, more than 50 inflammatory lesions, or a total lesion count of more than 125.
Acne Vulgaris Lesion Scoring
The severity score is the result of adding up the six regional subscores, which are obtained by multiplying the factor for each region (two seconds for the forehead and cheeks, one second for the nose and chin, and three seconds for the chest and back) by the most severely weighted lesion within that region (1 for ≥ 1 comedone, 2 for ≥ 1 papule, 3 for ≥ 1 pustule, and 4 for ≥ 1 nodule). Global Acne Grading System (GAGS) scoring methodology was based on a quantitative scoring system.13
Sampling and Preparation
A total of 5 mL of venous blood was collected from each participant and divided into two aliquots. Accordingly, 3 mL was placed in a standard tube, allowed to clot for 30 minutes at room temperature, and then centrifuged for 10 minutes at 4,000 revolutions per minute. The serum was separated and stored for the determination of TIMP-2 (ng/mL) by enzyme-linked immunosorbent assay (ELISA). Additionally, 2 mL of blood was collected into a Vacutainer tube containing EDTA for mRNA extraction, and the extract was stored at -80 °C until the RT-PCR step.
Protein and Gene Analysis
Human serum TIMP-2 concentrations (ng/mL) were measured using the SUN RED (ST) ELISA kit (Shanghai). Quantitative real-time PCR was performed using the TIMP-2 gene as the target and GAPDH as the housekeeping (reference) gene. We used the miRNeasy Mini preparations (catalogue number 217004, Qiagen, Germany) for whole RNA extraction, combining silica-membrane purification with phenol/guanidine-based lysis. A Thermo Scientific (USA) NanoDrop 2000 spectrophotometer, set to measure absorbance at 260 and 280 nm, was used to determine the RNA concentration. A high-capacity cDNA synthesis kit with an inhibitor (Thermo Fisher Scientific, Applied Biosystems, USA) was used for reverse transcription (RT) of RNA into cDNA. RT was conducted using 10 μL of RNA in a 20 μL reaction volume, and 2 μL of RT random primers, 2 μL of dNTP mix, 1 μL of RNase inhibitor, and 1 μL of reverse transcriptase MultiScribe, and 2 µL nuclease free water. Incubation was done in a 2720 thermal cycler (Applied Biosystems, Singapore), single cycle at 25 °C for 5 minutes, for 60 minutes at 42 °C, and 70 °C for 5 minutes.
The expression levels of TIMP2 and GAPDH were quantified by qRT-PCR. The TIMP-2 forward primer was 5′ ACCCTCTGTGACTTCATCGTGC 3′, and the TIMP-2 reverse primer was 5′ GGAGATGTAGCACGGGATCATG 3′. The GAPDH forward primer was 5′CTCTGCTCCTCCTGTTCGAC3′, and the GAPDH reverse primer was 5′ TTAAAAGCAGCCCTGGTGAC3′. Each reaction for each gene was performed in a final volume of 20 mL, 5 μL of nuclease-free water was used. 3 μL of cDNA mix. 10 μL mL SYBR Green 2x QuantiTect PCRMaster. One mL forward primer, 1 mL reverse primer. The mix was incubated at 94 °C for 3 min, followed by 60 cycles; denaturation at 94 °C for 30 s, for 40 s for annealing at 55 °C and extension at 72 °C for 31 s.
All experimental conditions were carefully controlled, and PCR amplification efficiency was verified. Comparable amplification efficiencies for the target and housekeeping genes were assumed. The melting curve was produced (Figures 1 and 2). Higher Ct values were associated with lower RNA levels. The relative quantification values for each unique gene were determined using the 2-ΔΔCt formulation14 in the following manner:
Statistical Analysis
For the statistical analysis, an IBM personal computer running the statistical programs Epi Info 2000 (Centers for Disease Control and Prevention, Atlanta, GA, USA) and SPSS version 20.0 (IBM Corp., Armonk, NY, USA) was used. Descriptive statistics were performed as follows: categorical data were presented as numerical counts (N) and percentages (%), and quantitative data were presented as mean (X), range, and standard deviation (SD). Among the analytical procedures employed were the Spearman correlation coefficient test (r), the Mann–Whitney U test (U), the chi-square test (X2), and the Kruskal–Wallis test (K). At P ≤ 0.05, the significance threshold was applied.
RESULTS
This case-control study included 35 males (42.2%) and 48 females (57.8%). Ages ranged from 16 to 28 years, with 20.82 ± 2.69 years for the mean ± SD value. Controls consisted of 35 (42.2%) males and 48 (57.8%) females, with ages ranging from 16 to 28 years. Mean ± SD value was 20.82 ± 2.69 years.
Clinical information for the studied cases of acne vulgaris is presented in Table 1.
Appraisal of Mean Serum TIMP-2 Level and Mean Expression Level of TIMP-2 Gene Between Patients and Control Subjects
Upon studying the mean serum level of TIMP-2 and the mean expression level of the TIMP-2 gene, there were statistically significant differences, both being higher in cases (63.58 ± 29.80 ng/mL) than in control subjects (22.36 ± 7.88 ng/mL) (P < 0.001 for both) (Table 2).
Relationship Between the Mean Serum Level of TIMP-2 (ng/mL) and Clinical Information of the Studied Patients
A significant association between the mean serum TIMP-2 level (ng/mL) and aggravating factors such as sun exposure (P = 0.018) was observed. Additionally, significant relationships were found between the mean serum TIMP-2 level (ng/mL) and acne lesions on the back (P < 0.001) and chest (P = 0.001), NAST classification (P < 0.001), disease severity (P = 0.01), and GAGS grade (P < 0.001) (Table 3).
Correlation Between Serum TIMP-2 (ng/mL) and Age of Cases in Years, Disease Duration in Years, GAGS Score, and TIMP-2 Gene Expression
There were statistically significant positive correlations between mean serum TIMP-2 level (ng/mL) and duration of disease in years (r = 0.265, P = 0.015), GAGS score (r = 0.852), P < 0.001, and TIMP-2 gene expression level (r = 0.695), P < 0.001 (Figure 3a-c).
Relationship Between Mean TIMP-2 Gene Expression Level and Clinical Information of the Studied Patients
Significant associations were observed between the mean expression level of the TIMP-2 gene and (1) acne lesions on the chest (P = 0.031), (2) NAST classification (P < 0.001), and (3) GAGS grade (P < 0.001) (Table 4).
Correlation Between TIMP-2 Gene Expression and Age of Cases in Years, Disease Duration in Years, and GAGS Score
Significant positive correlations were observed between TIMP-2 gene expression and duration of disease in years (r = 0.286, P = 0.009), and between TIMP-2 gene expression and GAGS score (r = 0.672, P <0.001) (Figure 4a and b respectively).
ROC Curve for Serum TIMP-2 (ng/mL) and Expression of the TIMP-2 Gene to Distinguish Cases from Control Subjects
For serum TIMP-2 (ng/mL), the receiver operating characteristic (ROC) curve showed a cut-off value of ≥ 31, with a sensitivity of 92.77%, specificity of 80.72%, and an area under the curve (AUC) of 0.969, which was statistically significant (P < 0.001). In comparison, TIMP-2 gene expression at a cut-off value of ≥ 1.5 had a sensitivity of 93.98% and specificity of 100.0%. The AUC was 0.996 (P < 0.001), indicating a significant ability to distinguish acne vulgaris cases from controls (Figure 5a).
ROC Curve for Serum TIMP-2 (ng/mL) and TIMP-2 Gene Expression to Discriminate Disease Severity
A ROC curve was applied to serum TIMP-2 (ng/mL) and TIMP-2 gene expression to determine their sensitivity and specificity for stratifying disease severity. Serum TIMP-2 at a cut-off value of ≥ 47 had a sensitivity of 60.71% and specificity of 61.82%. The AUC was 0.645, with a statistically significant result (P = 0.031). In comparison, TIMP-2 gene expression at a cut-off value of ≥ 3.1 had a sensitivity of 50.0% and specificity of 49.09%. The AUC was 0.548, which was not statistically significant (P = 0.479) (Figure 5b).
DISCUSSION
Acne vulgaris is an inflammatory skin disorder that affects the pilosebaceous unit. It may present as non-inflammatory lesions, inflammatory lesions, or a combination of both. The pathogenesis of acne is multifactorial and involves several factors: C. acnes activity, excess sebum production, and follicular hyperproliferation.15
MMP-2 is a Zn+2-dependent endoproteinase that is involved in the disruption of sebaceous glands.16 TIMP-2 is a unique inhibitor within the TIMP family that inhibits the proteolytic activity of MMP-2.17
The balance between TIMPs and MMPs controls the modification of the extracellular matrix and the imbalance between them may lead to the development of acne and other inflammatory disorder.5
Although TIMP-2 is classically recognized as an inhibitor of MMP-2, its increased expression may represent a compensatory response to enhanced extracellular matrix remodeling and inflammation associated with acne pathogenesis. Elevated TIMP-2 levels may reflect an attempt to counterbalance increased MMP activity and limit tissue damage during chronic inflammatory processes. Furthermore, TIMP-2 has been reported to exert biological functions beyond MMP inhibition, including regulation of cell proliferation, apoptosis, and tissue remodeling. Therefore, increased circulating TIMP-2 may serve as a marker of ongoing inflammatory and remodeling events rather than a direct pathogenic factor.18
The elevated serum TIMP-2 levels and gene expression observed in patients with acne vulgaris may represent a compensatory regulatory response to the inflammatory and extracellular matrix remodeling processes associated with the disease. As TIMP-2 is a major endogenous inhibitor of MMP-2 and plays an important role in maintaining extracellular matrix homeostasis, its upregulation may reflect an attempt to counterbalance increased proteolytic activity and tissue remodeling during inflammation. Similar regulatory functions of TIMP-2 have been described in several inflammatory and tissue-remodeling conditions.19 Beyond its inhibitory activity against MMPs, TIMP-2 contributes to tissue homeostasis through MMP-independent mechanisms, including the regulation of cellular proliferation, angiogenesis, and tissue remodeling. Therefore, increased TIMP-2 expression may also reflect a broader protective response to ongoing inflammatory processes.20 However, MMP-2 levels were not measured in the current study. Consequently, the proposed compensatory role of TIMP-2 cannot be directly confirmed, and our findings should be interpreted as demonstrating an association between increased TIMP-2 levels and acne severity rather than establishing a causal mechanism. Future studies that evaluate both TIMP-2 and MMP-2 are warranted to clarify their interaction in the pathogenesis of acne vulgaris.
Papakonstantinou et al.21 investigated the expression of MMPs and their inhibitors in the facial sebum of patients with acne, both before and after isotretinoin treatment, and documented the presence of TIMP-2 in the sebum of acne patients, which was not influenced by isotretinoin treatment. Other studies investigated TIMP-2 tissue expression in acne patients, including Saint-Jean et al.22 which found that TIMP-2 expression was significantly stronger in papules of patients prone to acne scars compared to patients not prone to scars.
The expression of TIMP-2 was studied only in sebum and tissue cultures, but not in the blood of acne vulgaris patients,21, 22 whereas the current study aimed to assess serum TIMP-2 levels in cases of acne vulgaris to better understand its role in acne vulgaris etiopathogenesis.
This study found that mean serum TIMP-2 levels were significantly higher in acne vulgaris patients than in control subjects. Indeed, a significant relationship between the mean serum TIMP-2 level and aggravating factors, such as sun exposure and pregnancy, was observed.
This may be explained by the rising TIMP-2 level, which decreases MMP-2. Gao et al.16 stated that there may be an increase in proinflammatory cytokine production leading to systemic inflammation if MMP-2 activity declines below baseline. Additionally, they reported that lipid dysregulation, including decreased liver X receptor-α levels and increased hepatic triglyceride production, was caused by MMP-2 deficiency, and that similar dysregulation was also reported in acne.
The concentration of TIMP-2 is higher in acne lesions on the back and chest. Dagnelie et al.23 reported that cases with acne on the back exhibit a loss of C. acnes phylotypes, particularly phylotype IA1, thereby activating innate immunity. Saint-Jean et al.22 documented a distinct innate immunity profile in the normal skin of back acne patients with and without acne scars. In patients who developed scars, considerable overexpression of TLR-4, interleukin (IL)-2, IL-10, TIMP-2, and the transcription factor JUN, alongside decreased MMP-9 protein levels, was observed.
The results of this investigation showed significant positive correlations between mean serum TIMP-2 levels and both disease duration (years) and NAST classification; TIMP-2 serum levels were significantly higher among patients with prolonged disease duration and inflammatory lesions. This finding was consistent with Gao et al.,16 who confirmed that inhibited MMP-2 activity may lead to overexpression of IL-1α and β, tumor necrosis factor-α, and triglycerides, thus promoting inflammation and lipid dysregulation in acne.
The current study supported the use of TIMP-2 as a marker for the diagnosis of acne vulgaris, with a cut-off value of ≥ 31, yielding a sensitivity of 92.77%, specificity of 80.72%, and an AUC of 0.969, with a statistically significant result (P < 0.001). It can also be used to detect the severity of acne vulgaris, as serum TIMP-2 shows significant diagnostic performance in discriminating between severe and mild/moderate disease at a cut-off of ≥ 47, with a sensitivity of 60.71% and specificity of 61.82%. AUC was 0.645 with a statistically significant result (P = 0.031)
This suggests that acne patients with high TIMP-2 levels are more likely to develop severe, extensive disease and scarring. Chuah and Goh24 suggested that predicting the susceptibility to severe acne is very important, as early treatment is easier and prevents the serious side effects of post-acne scarring.
Many studies have investigated the TIMP-2 gene polymorphism in acne vulgaris. Yaykasli et al.10 documented twofold higher expression of the TIMP-2-418CC genotype in cases with acne vulgaris.
Furthermore, Gao et al.16 conducted a study of the Chinese population and found no significant correlation between the TIMP-2-41/C polymorphism and acne vulgaris. Gupta et al.25 found no evidence of increased risk of acne or atrophic post-acne scars associated with the TIMP-2 nucleotide polymorphism (rs8179090).
Moreover, TIMP-2 mRNA expression is associated with many skin disorders, including psoriasis,26 systemic lupus erythematosus,27 non-melanoma skin cancer,28 and oral lichen planus.29 However, the association between TIMP-2 mRNA expression and the occurrence of acne vulgaris has not been studied to date.
The current study showed a significant difference between patients with acne vulgaris and control subjects, with TIMP-2 gene expression levels higher in patients than in control subjects.
The results of the present study showed significant associations between mean TIMP-2 gene expression levels and acne lesions on the chest, NAST classification, and disease duration (years), with higher levels observed in patients with chest lesions, inflammatory acne, and longer disease duration.
The current study supported the use of TIMP-2 gene expression as a marker for the diagnosis of acne vulgaris, with a cut-off value of ≥ 1.5, demonstrating 93.98% sensitivity and 100.0% specificity. The AUC was 0.996, which was statistically significant.
A significant positive correlation was observed between the mean serum TIMP-2 level and TIMP-2 gene expression. The TIMP-2 gene encodes the TIMP-2 protein; therefore, increased expression of the TIMP-2 gene results in higher levels of its protein product.
In the current study, the mean serum TIMP-2 level was significantly associated with disease severity, GAGS grade, and score. Indeed, a significant positive correlation between TIMP-2 gene expression and GAGS grade and score was documented.
Both TIMP-2 gene expression and serum levels were higher in patients with severe acne, defined by a high GAGS score using lesion type rather than lesion count. This finding can be explained by the likelihood that acne lesions may leave permanent scars, which increases with the depth of the inflammatory process.30 In line with this finding, Wen et al.31 revealed that the risk of acne scarring was associated with TIMP-2 (rs4789932).
Study Limitations
The current study has some limitations. First, MMP-2 levels were not assessed; therefore, the functional relationship between TIMP-2 and MMP-2 could not be directly investigated. Second, the case-control design precludes establishing causal relationships between elevated TIMP-2 levels and acne development or progression. Future longitudinal studies incorporating simultaneous measurement of TIMP-2 and MMP-2 are recommended to clarify the underlying mechanisms.
CONCLUSION
The present study demonstrated that both serum TIMP-2 levels and TIMP-2 gene expression are significantly elevated in patients with acne vulgaris compared with healthy individuals. Furthermore, the positive correlations of serum TIMP-2 levels and its gene expression with acne severity scores (GAGS and NAST classification) suggest a probable role for TIMP-2 in the pathogenesis and progression of acne vulgaris. These findings indicate that TIMP-2 may serve as a useful biomarker of disease activity and severity, highlighting its potential utility in the evaluation and management of acne vulgaris. Further studies are warranted to elucidate the underlying mechanisms and explore its potential as a therapeutic target.
